| PATENT NUMBER | This data is not available for free |
| PATENT GRANT DATE | November 16, 1999 |
| PATENT TITLE |
Vaccines for plague |
| PATENT ABSTRACT |
A method of protecting a human or animal body from the effects of infection with Y. pestis is provided comprising administering to the body a vaccine including Yersinia pestis V antigen and Yersinia pestis F1 antigens or a protective epitopic part of each of these in a form other than whole Y. Pestis organisms. Preferably the antigens are administered in the form of a live vaccine or as recombinantly produced isolated and/or purified proteins. DNA encoding the whole or part of the F1 antigen and DNA encoding the whole or part of the V antigen may be used directly as a agnetic vaccine. |
| PATENT INVENTORS | This data is not available for free |
| PATENT ASSIGNEE | This data is not available for free |
| PATENT FILE DATE | September 15, 1997 |
| PATENT CT FILE DATE | March 13, 1996 |
| PATENT CT NUMBER | This data is not available for free |
| PATENT CT PUB NUMBER | This data is not available for free |
| PATENT CT PUB DATE | September 19, 1996 |
| PATENT FOREIGN APPLICATION PRIORITY DATA | This data is not available for free |
| PATENT REFERENCES CITED |
FEMS Immunology and Medical Microbiology, 12 (3-4), 1995 223-230., XP000573083 Williamson E D et al: "A new improved sub-unit vaccine for plague: The basis of protection" see the whole document. Leary S E C et al: "Expression of Yersinia pestis V antigen in attenuated Salmonella typhimurim: Development of a novel vaccine for plague", Karger AG, 13 (0). 1995. 216-217., Basel, Switzerland XP000572863 in Ravagnan G & Chiesa C (eds): Yersiniosis: Present and Future. Infection and Immunity, vol. 63, No. 2, Feb. 1995, Washington US, pp. 563-568, XP002006749 Oyston P C F et al.: "Immunization with live recombinant Salmonella typhimurium aroA producing F1 antigen protects against palgue" cited in the application see the whole document. Infection and Immunity, vol. 62, No. 10, Oct. 1994, Washington US, pp. 4192-4201, XP002006750 Motin V L et al.: "Passive immunity to Yersiniae mediated by anti-recombinant V antigen and protein A-V antigen fusion peptide" see the whole document. Simpson et al. Am. J. Trop. Med. Hyg. 43 (4): 389-396, 1990. Burrows. Nature 179: 1246-1247, 1957. Burrows et al. Br. J. Exp. Pathol. 39: 278-91, 1958. Gremyakina et a. Mol. Gen. Mikrobiol. Virusol. VI, Jan.-Feb. 23-26, 1994. Motin et al. In: Abstracts of the 94th General Meeting of the American Society for Microbiology, abstract E-68, pp. 155, 1994. Price et al. J. Bacteriol. 173 (8): 2649-2657, 1991. Brubaker, Contrib. Microbiol. Immunol. Basel, Karger, vol. 12, pp. 127-133, 1991. Sato et al. Contrib. Microbiol. Immunol. Basel, Karger, vol. 12, pp. 225-229, 1991. Meyer et al. J. Infect. Dis. 129 Suppl: S41-S45, 1974. Lawton et al. J. Immunol. 91: 179-184, 1963. Galyov et al. FEBS Lett. 277 (1, 2): 230-232, 1990. Galyov et al. FEBS Lett. 286 (1, 2): 79-8, 1991. Price et al. J. Bacteriol. 171 (10): 5646-5643, 1989. Anisomov et al. Mol. Gen. Mikrobiol. Virusol. 2: 24-27, abstract, 1987. Leary et al. Infect. Immun. 63: 2854-2858, 1995. Une et al. J. Immunol. 133 (4): 226-230, 1984. |
| PATENT PARENT CASE TEXT | This data is not available for free |
| PATENT CLAIMS |
We claim: 1. A method of protecting a human or animal body from the effects of infection with Yersinia pestis comprising administering to the body a vaccine consisting essentially of isolated or purified Yersinia pestis V antigen and Yersinia pestis F1 antigen or a protective epitopic part of each of these in a form other than whole Yersinia pestis organisms. 2. A method as claimed in claim 1 wherein the antigens are administered in the form of a live vaccine. 3. A method as claimed in claim 2 wherein the live vaccine comprises human or animal gut colonising organisms that have been transformed using recombinant DNA to enable each organism to express both of V antigen and F1 antigen. 4. A method as claimed in claim 3 wherein the gut colonising organisms have been transformed with recombinant DNA such that they are enabled to express a fusion protein comprising both V and F1 antigen amino acid sequences or a protective epitopic part of each. 5. A method as claimed in claim 3 wherein the DNA comprises DNA of SEQ ID No 1 orSEQ ID No 3. 6. A method as claimed in claim 5 wherein the DNA is positioned in frame with a promoter selected from be group consisting of the Iacz promoter or Nir.beta. promoter. 7. A method as claimed in claim 3 wherein the DNA comprises DNA of SEQ ID No 10. 8. A method as claimed in claim 1 wherein the antigens are provided in a pharmaceutically acceptable carrier. 9. A method as claimed in claim 8 wherein the carrier is such as to proouce an oil-in-water emulsion. 10. A method as claimed in claim 1 wherein the vaccine includes an adjuvant. 11. A method as claimed in claim 1 wherein the vaccine is administered such that it is enabled to induce local stimulation of the gut-associated lymphoid tissue (GALT) and, by trafficking of lymphocytes through the common mucosal immune system provide a secondary stimulation of the bronchial associated lymphoid tissue (BALT) such that a secretory IgA response is achieved at the respiratory mucosal surface. 12. A method as claimed in claim 1 wherein the vaccine is in the form of droplets or capsules. 13. A method as claimed in claim 12 wherein the capsules are liposomes or microcapsules effective in delivering the composition to the airways of an individual for the purposes of evoking mucosal immune response. 14. A vaccine consisting essentially of isolated or purified recombinant Yersinia pestis V antigen and Yersiniapestis F1 antigen or a protective epitopic part of each of these in a form other than whole Yersinia pestis organisms. 15. A vaccine as claimed in claim 14 characterised in that it is a live vaccine. 16. vaccine as claimed in claim 15 wherein the live vaccine comprises human or animal gut colonising organisms that have been transformed using recombinant DNA to enable them to express one or both of V antigen and F1 antigen. 17. A vaccine as claimed in claim 16 wherein the gut colonising organisms have been transformed with recombinant DNA such that they are enabled to express a fusion protein comprising both V and F1 antigen amino acid sequences or a protective epitopic part of each. 18. A vaccine as claimed in claim 16 wherein the DNA comprises DNA of SEQ ID No 1 or SEQ ID No 3. 19. A vaccine as claimed in claim 18 wherein the DNA is positioned in frame with a lacz or nir.beta. promoter. 20. A vaccine as claimed in claim 16 wherein the DNA comprises DNA of SEQ ID No 10. 21. A vaccine as claimed in claim 14 wherein the antigens are provided in a pharmaceutically acceptable carrier. 22. A vaccine as claimed in claim 21 wherein the carrier is such as to produce an oil-in-water emulsion. 23. A vaccine as claimed in claim 14 or 21 characterised in that it includes an adjuvant. 24. A vaccine as claimed in claim 14 or 21 characterised in that it is in the form of droplets or capsules. 25. A vaccine as claimed in claim 24 wherein the capsules are liposomes or microcapsules effective in delivering the composition to the airways of an individual for the purposes of evoking mucosal immune response. 26. A vaccine as claimed in claim 24 wherein the capsules are block co-polymers. 27. A vaccine as claimed in claim 24 wherein the capsules comprise biodegradable polymers. 28. A vaccine as claimed in claim 27 wherein the biodegradable polymer is poly-lactic acid. 29. A vaccine as claimed in claim 28 further comprising glycollic acid. 30. A vaccine as claimed in claim 28 further comprising block co-polymer. 31. A vaccine according to either of claims 26 in which the block co-polymer contains the repeat unit (POP-POE).sub.n. 32. A method as claimed in claim 5 wherein the DNA is positioned in frame with an in-vivo inducible promoter. 33. A method according to claim 32 wherein the in-vivo inducible promoter is selected from HtrA, nir.beta., OmpR, OmpC, or PhoP. 34. A method as claimed in claim 5 wherein the DNA is positioned in frame with a constitutive promoter. 35. A method according to claim 34 wherein the constitutive promoter is Osmz or lacz. 36. A method as claimed in claim 3 wherein the DNA comprises DNA of SEQ ID No 7 or 8 or 9. 37. A method as claimed in claim 3 wherein the DNA comprises DNA of SEQ ID No 16. 38. A method as claimed in either of claim 3 wherein the vaccine comprises DNA of any one of the following SEQ ID Nos: 1, 3 and 10. 39. A method as claimed in claim 4 wherein the DNA comprises DNA of SEQ ID No 20 or 22. 40. A method as claimed in claim 39 wherein the DNA is positioned down-stream of a eukaryotic promoter. 41. A method according to claim 40 wherein the eukaryotic promoter is a CMV immediate early promoter. 42. A method as claimed in claim 8 wherein the carrier is water. 43. A vaccine as claimed in claim 16 wherein the DNA comprises DNA of any of the sequences 7,8,9,10, and 16. 44. A vaccine as claimed in claim 18 wherein the DNA is positioned in frame with an in-vivo inducible promoter selected from the group consisting of htrA, nirB, ompR, ompC and phoP. 45. A vaccine as claimed in claim 18 wherein the DNA is positioned in frame with a constitutive promoter selected from Osmz or lacz. 46. A vaccine as claimed in claim 18 wherein the DNA is positioned downstream of a eukaryotic promoter. 47. A vaccine as claimed in claim 46 wherein the DNA comprises DNA of SEQ ID No 20 or 22. 48. A vaccine according to claim 21 wherein the carrier is water. |
| PATENT DESCRIPTION |
The present invention relates to novel vaccines for provision of protection against infection with the organism Yersinia pestis and to methods for administering these. Particularly provided are parenterally and orally active vaccines capable of offering protection against bubonic and pneumonic plague. particularly by induction of mucosal immunity in both humans and other animals. Yersinia pestis is the highly virulent causative organism of plague in a wide range of animals, including man. Infection with such organisms results in a high rate of mortality. Studies have shown that the high virulence is due to a complex array of factors encoded by both the chromosome and three plasmids, including the Lcr genes, a fibrinolysin and a capsule. Man is an occasional host in the natural cycle of the disease, and bubonic plague, characterised by the swelling of local lymph nodes, may occur following the bite of an infected flea. One of the complications of bubonic plague is secondary pneumonia, and in these cases the disease is readily transmitted between humans by airborne droplets. Plague is endemic in regions of North and South America, Africa, China and Asia (see Butler (1983) Plague and Other Yersinia Infections; Plenum Press, New York). Current outbreaks are believed to be part of the fourth world pandemic of the disease, with a clear need to protect individuals living or travelling in endemic areas, and laboratory workers handling the bacterium. The current whole cell vaccines available for prevention of plague are highly heterogeneous. resulting in side effects which make them unsuitable for widespread use (eg Meyer et al (1974) J. Infect Dis 129 supp 13-18 and 85-120: Marshall et al (1974) ibid supp 19-25). One current vaccine for plague is the Cutter vaccine which comprises formaldehyde killed plague bacilli and is administered to the body by intramuscular injection. However, parenteral immunisation, although effective in inducing systemic immunity, does not effectively induce mucosal immunity (McGhee et al, (1992) Vaccine 10, 75-88) and cases of pneumonic plague have been reported in vaccinated individuals (Meyer (1970) Bull WHO 42 p663-668). So far no vaccine capable of producing a protective immune response at mucosal surfaces has been reported. The live attenuated EV76 vaccine was tested extensively and used in the former Soviet Union from 1939, although its efficacy in evoking an immune response in man is questionable (Meyer et al (1974) J. Infect. Dis. 129 Supp: 13-18). It has been shown that the virulence of EV76 differs in several animal species. and non-human primates are particularly susceptible to a chronic infection with this strain. In the Western World the vaccine is considered to be unsuitable for mass vaccinations due to the extreme severity of the side effects and the possibility of the strain reverting to full virulence. Two known Y. pestis antigens are the Y. pestis LcrV (V antigen), and the Fl antigen: both of which have now been found to be capable of evoking protective immune responses in animals. The present inventors have previously provided live orally active vaccine microorganisms capable of expressing V antigen and F1 antigen respectively which each provide good protection against challenge with Y. pestis at up to 10.sup.3 cfu. These vaccines are the subject of copending patent applications PCTIGB94/02818 and GB 9404577.0. The present inventors have now surprisingly found that whereas only the unacceptably hazardous EV live vaccine had been shown to be capable of giving good protection against challenge with 10.sup.9 cfu or more with Y. pestis GB strain, and V and F1 antigens alone only provide full protection against challenge with about 10.sup.5 cfu. by administering a combined vaccine comprising V and F1 antigens they can at least match the protection afforded by EV76 without any of the hazards that have kept the EV vaccine from general use. Still more advantageously, they have found that the vehicle for administration may be a simple mixture of the two protein components, rather than as a more complex attenuated whole organism. For long term protection and for the purposes of producing mucosal immunity, they have provided preferred forms of vaccine compnsing the two components in the form of live attenuated vaccine such as the F1 and V expressing Aro A or C Salmonella typhi referred to in the aforesaid copending applications, and in more preferred forms a single or double mutant expressing these antigens separately, or a fusion protein comprising both antigens. Further provided are micro-organisms comprising both of Fl and V types of construct or plasmids of the applicants copending applications referred to above. These contain constructs that are capable of transforming a human or animal gut colonising micro-organism such that it is enabled to express proteins that are equivalent in sequence to F1 and V antigens respectively; these producing a protective immune response against Yersinia pestis in a human or animal body when the micro-organism is administered by oral or parenteral routes, and preferably allow the micro-organism to maintain its ability to colonise the human or animal gut. A particularly preferred recombinant DNA, plasmid or human or animal gut colonising organism encodes for or expresses all or a protective epitopic part of the mature V protein of Yersinia pestis and all or a protective epitopic part of the mature Fl protein of Yersinia pestis. DNA encoding the whole or part of the F1 antigen and DNA encoding the whole or part of the V antigen could be used directly as a genetic vaccine. Particularly preferred recombinant DNA encoding for V comprises a DNA sequence as described in SEQ ID No 1 or SEQ ID No 3, more preferably positioned in frame with a promoter such as lacz or nir.beta., and preferably in a vector capable of expression and replication in a Salmonella. Particularly preferred recombinant DNA encoding for F1 comprises a DNA sequence as described in SEQ ID No 10. SEQ ID No 2 and SEQ ID No 4 show the amino acid sequences of two preferred V antigen proteins; SEQ ID No 2 being the sequence of the V-antigen itself, and SEQ ID No 4 being that of V-antigen with four extra vector defined N-terminal amino acids. SEQ ID No 11 is that of an F1 protein as encoded for by SEQ ID No 10. The preferred DNA constructs used in microorganisms of the invention allow production of micro-organisms that when orally administered induce local stimulation of the gut-associated lymphoid tissue (GALT) and, by trafficking of lymphocytes through the common mucosal immune system provide a secondary stimulation of the bronchial associated lymphoid tissue (BALT). In this manner a secretory IgA response is achieved at the respiratory mucosal surface. The micro-organisms provided by transformation using this DNA in vector or directly inserted format, are preferably attenuated, more preferably attenuated salmonella. Attenuated micro-organisms such as S. typhimurium have been well characterised as carriers for various heterologous antigens (Curtiss, (1990); Cardenas and Clements, (1992)). Attenuation may be effected in a number of ways, such as by use of the aro A and/or aro C mutation approach (see Hosieth et al (1981) Nature 291. 238-239: Dougan et al (1986) Parasite Immunol 9, 151-160; Chatfield et al (1989) Vaccine 7, 495498); multiple mutations such as aro A and aro C mutants as described by Hone et al (1991) Vaccine 9, pp 810-816 may also be used. However, any suitably defective organism that is safe for intended use may be employed. Many other such attenuated deletions and mutations will be known for these and other microorganisms which will render them suitable for transformation with constructs of the present invention for the purposes of expressing vaccine proteins in the gut and/or gut colonisation in animals to be treated for Y.pestis. For human vaccination vectors containing the constructs of the present invention are placed in attenuated S. typhi and that transformed organism used as active agent for a live oral vaccine. When DNA is used to transform the attenuated micro-organism by direct insertion into microorganism DNA this may be by direct integration into a gene. Alternatively when incorporated in the form of a plasmid that expresses V or F1 protein or epitopic fragments thereof this may be such that only the V or F1 protein or fragment is expressed or that this is expressed as a fusion peptide with a further protein or peptide fragment, preferably including the other one of the antigenic F1/V components. Such further protein or peptide fragment might be such as to promote export of mature proteins or peptide through the cell membrane or might be a further Y. pestis antigen. The Icr gene was cloned from Y. pestis strain KIM by Price et al and its nucleotide sequence published in J Bacteriol (1989) 171, pp 5646-5653. In the examples below this information was used to design oligonucleotide primers which could amplify the gene from Y. pestis (strain GS) using the polymerase chain reaction (PCR). PCR primers were designed to be complementary to respective sequences flanking the 5' and 3' ends of the Icrv gene but also having 5' end tails containing a restriction enzyme recognition site to enable amplified IcrV gene to be cloned directionally into a plasmid vector (the 5' PCR primer containing an EcorRI site and the 3' primer containing a SacI site). These restriction enzyme sites are examples only and should not be seen as excluding other restriction enzymes. In the examples below the constructs of the invention include a lac promoter, but other promoters such as the macrophage promoter (nir.beta.) may be used. The production of Fl has been described fully in Oyston et al (1995) Infect. Immun. Vol. 63 No 2 p563 - see page 564 under results: Cloning and Expression of caf1. The dosage of the antigen components in a vaccine may vary dependent upon an individual animals immune characteristics, but for immunisation in the mouse animal model of the examples below it has been found that 10 .mu.g of each of V and F1 per dose were effective in providing full protection when administered in a standard primer and booster schedule. The antigens may be incorporated into a conventional pharmaceutically acceptable carrier, no particular limitation being imposed here. Conveniently the antigens have been incorporated into an oil in water emulsion. Adjuvants may be included in the vaccine composition, and particularly Freund's Incomplete adjuvant IFA has been found to be effective when treating the mouse model. The carrier may be one suited to parenteral administration, particularly intraperitoneal administration but optionally oral, in the case of micro-organism based vaccines, or administration in the form of droplets or capsules, such as liposomes or microcapsules as would be effective in delivering the composition to the airways of an individual for the purpose of evoking mucosal immune response. The carrier may also comprise a slow-depot release system e.g. Alhydrogel. Another method of encapsulation includes the use of polymeric structures in particular linear block co-polymers. Biodegradable polymers for example poly-lactic acid with or without glycolic acid or block co-polymer may be used; these may contain the following repeat unit: (POP-POE).sub.n where POP is polyoxypropylene and POE is polyoxyethylene. Block copolymers which contain (POP-POE).sub.n are of particular use. The method, constructs, micro-organisms and vaccines of the invention will now be exemplified by way of illustration only by reference to the follcwing Sequence using Figure and Examples. Still further embodiments will be evident to those skilled in the art in the light of these. FIG. 1 illustrates in bar-chart form the survival rates of a number of groups against a challenge of Y.pestis. FIG. 2 illustrates in graphical form, IgG priming responses to intramuscular BSA immunisation in Balb/c mice. SEQUENCE LISTING SEQ ID No 1: Shows the nucleotide and derived amino acid sequence of a V-encoding DNA with 6 bases of vector pMAL-p2 or pMAL-c2 into which it is cloned at the 5' end using the EcoRI site in sequence GAATTC (derived from the 5' end PCR primer) and at the 3' end at the Sall site in sequence GTCGAC (derived from the 3' end PCR primer). The base at position 1006 has been altered by PCR mutagenesis to a T to create a second in frame stop codon. The start of the amino acid sequence is C-terminal to a factor Xa cleavage site. SEQ ID No 2: Shows the amino acid sequence of the peptide expressed by the insert DNA of the invention, with an additional four amino acids encoded for by the vector (IE+FS) at the N-terminal end. SEQ ID No 3: Shows the nucleotide and derived amino acid sequence of a second V-encoding DNA of the invention with 10 bases of a vector pGEX-5X-2 into which it is cloned shown at the 5' end using the EcoRl site in sequence GAATTC (GA derived from the 5' end PCR primer) and the Sall site in sequence GTCGAC (GTCGAC derived from the 3' end PCR primer). The base at position 1006 has been altered by PCR mutagenesis to create a second in frame stop codon; the base at position 16 has been altered to a C from an A to create the EcoRI site. The start of the amino acid sequence is C-terminal to a factor Xa cleavage site. SEQ ID No 4: Shows the amino acid sequence of the peptide expressed by the DNA of SEQ ID No 3, with four amino acids encoded by the vector (G, I, P and G) at the N-terminal end. SEQ ID No 5: Shows the nucleotide sequence of a gene 5' end primer oligonucleobde used to generate V-encoding DNA used in SEQ ID No 1. SEQ ID No 6: Shows the nucleotide sequence of a gene 3' end primer oligonucleotide used to generate V-encoding DNA used in the Examples. SEQ ID No 7: Shows the nucleotide sequence of a PCR primer oligonucleotide corresponding to the first 21 bases encoding for mature caf1 with an additional 5' region encoding for a SacI site. SEQ ID No 8: Shows the nucleotide sequence of a PCR primer oligonucleotide corresponding to the sequence of caf1 which encodes a `stem loop` downstream of the termination codon with an added 5' region encoding SacI and AccI sites. SEQ ID No 9: Shows the nucleotide sequence of a PCR primer oligonucleotide corresponding to an internal end region of the caf1 gene starting 107 bases downstream from the end of the first oligonucleotide. SEQ ID No 10: Shows the nucleotide sequence of the pFGAL2a construct showing the fusion of the first few bases of the .beta.-galactosidase sequence in the vector with caf1 minus its signal sequence and having a 5' tail including a Sac I restriction site: the sequence is shown up to the caf1 AACC 3' end with some vector bases. SEQ ID No 11: Shows the amino acid sequence of the protein encoded by OFGAL2a. This sequence may be proceeded by Met, Thr, Met, lie, Thr. Asn. SEQ ID No 12: is that of primer FIOU2 used to amplify the F1 operon. SEQ ID No 13: is that of primer M4D used to amplify the F1 operon. SEQ ID No 14: is that of primer M3U used to amplify the F1 operon. SEQ ID No 15: is that of primer FIOD2 used to amplify the F1 operon. SEQ ID No 16: is the nucleotide and derived amino acid sequence of a DNA fragment encoding an F1-V fusion protein. There is a SacI cloning site at the 5' end and a Hind III cloning site at the 3' end. Bases 452-472 is a sequence contained in the cloned insert, but derived from PCR primers (not found in Y. pestis DNA). SEQ ID No 17: is the amino acid sequence of SEQ ID No 16. SEQ ID No 18: is that of primer 5'FAB2 used to amplify the F1 operon including signal sequence. SEQ ID No 19: is that of primer 3'FBAM used to amplify the F1 operon including signal sequence. SEQ ID No 20: is the nucleotide and amino acid sequence for F1 antigen as defined by PCR primers detailed in exemplified SEQ ID No 18 and 19 including signal sequence. SEQ ID No 21: is the amino acid sequence of SEQ ID No 20. SEQ ID No 22: is the nucleotide and amino acid sequence of F1/V fusion protein including a 5 amino acid linker region. The T at position 1522 was modified from G to create a second in frame stop codon. SEQ ID No 23: is the amino acid sequence of SEQ ID No 22. The linker region referred to in SEQ ID No 22 is at amino acid position 171-176 (bases 523-540 in SEQ. ID No 22). SEQ ID No 24: shows the nucleotide sequence of a gene 5' end primer oligonucleotide used to generate V-encoding DNA used in SEQ ID No 3. EXAMPLES Cloning of SEQ. ID No 3 Materials and Methods: Materials for the preparation of growth media were obtained from Oxoid Ltd. or Difco Laboratories. All enzymes used in the manipulation of DNA were obtained from Boehringer Mannheim UK Ltd. and used according to the manufacturer's instructions. All other chemicals and biochemicals were obtained from Sigma chemical Co unless otherwise indicated. Monospecific rabbit polyclonal anti-V and mouse anti-GST sera were prepared by Dr R Brubaker (Department of Microbiology, Michigan State University) and Dr E D Williamson (Chemical and Biological Defence Establishment), respectively. Bacterial strains and cultivation: Yersinia pestis GB was cultured aerobically at 28.degree. C. in a liquid medium (pH 6.8) containing 15 g proteose peptone, 2.5 g liver digest. 5 g yeast extract. 5 g NaCl per liter supplemented with 80 ml of 0.25% haemin dissolved in 0.1M NaOH (Blood Base Broth). Escherichia coli JM109 was cultured and stored as described by Sambrook et al. Molecular Cloning. A Laboratory Manual. Production of recombinant V and F1 proteins: Manipulation of DNA. Chromosomal DNA was isolated from Y. pestis by the method of Marmur. Production of recombinant V-antigen: The gene encoding V-antigen (1crV) was amplified from Y. pestis DNA using the polymerase chain reaction (PCR) with 125pmoi of primers homologous to sequences from the 5' and 3' ends of the gene (see Price et al (1989). J. Bacteriol 171 p5646-5653). The sequences of the 5' primer (V/5'E: GATCGAATTCGAGCCTACGAACAA) and the 3' primer (GGATCGTCGACTTACATAATTACCTCGTGTCA) also included 5' regions encoding the restriction sites EcoR1 and Sal1, respectively. In addition, two nucleotides were altered from the published sequence of IcrV (Price et al, 1989), so that the EcoRI site was completed and the amplified gene encoded an extra termination codon (TAA). The PCR pnmers were prepared with a DNA synthesiser (392 Applied Biosystems) Applied Biosystems. A DNA fragment was obtained after 30 cycles of amplification (95.degree. C., 20secs, 45.degree. C., 20 secs, 72.degree. C. 30 secs: Perkin 9600 GeneAmo PCR System). The fragment was purified, digested with EcoR1 and Sal1. ligated with suitably digested plasmid pGEX-5X-2 and transformed into E. coli JM109 by electroporation (see Sambrook et al 1989). A colony containing the recombinant plasmid (pVG 100) was identified by PCR using 30-mer primers (5' nucleotides located at positions 54 and 794: see Price et al 1989) which amplified an internal segment of the IcrV gene. Expression of rV in E. coli. Cultures of E. coli JM109/pVG100 were grown in LB containing 100 .mu.gml.sup.-1 ampicillin at 37.degree. C. until the absorbance (600 nm) was 0.3. Isopropyl-.beta.-D-thiogalactopyranoside (IPTG) was then added to the culture to a final concentration of 1 mM and growth was continued for a further 5 hours. Whole cell lysates of the bacteria were prepared as described in Sambrook et al and expression of the GSTN fusion protein was examined by staining 10% SDS-polyacrylamide gels (Mini-Protean II, BioRad) with Coomassie Brilliant Blue R250 and by Western Blotting (see Sambrook et al). Western Blots were probed with rabbit anti-V serum diluted 1/4000 or mouse anti-GST serum in dilution at 1/1000 and protein bands were visualised with a colloidal gold labelled secondary antibody (Auroprobe BLplus, Cambio). Quantification of GSTN expression in vitro. Cultures of E. coli JM109 containing pVG1OO or pGEX-5X-2 were grown as described above. One ml aliquots were removed from the cultures in logarithmic and stationary phases and the number of viable cells determined by inoculating onto L-agar containing ampicillin. The cells were harvested from a second 1 ml aliquot by centrifugation and resuspended in 1 ml of phosphate buffered saline (PBS). The cell suspension was frozen at -20.degree. C. for 1 hour, thawed and then sonicated on ice at 10.degree. C. lower for 3.times.30 secs (model XL2015 sonicator, 3.2 mm Microtip probe; Heat Systems Inc.). The sonicates and a standard solution of rV (5ugml.sup.-1) were serially diluted in PBS in a microtitre plate and allowed to bind overnight at 4.degree. C. The quantity of GST/V fusion protein in eacn sonicate was determined in a standard ELISA using rabbit anti. V serum as the primary antibody. Antibodies were incubated in 1% skimmed milk powder in PBS. Purification of rV. E. coii JM109/pVG100 was grown in 5.times.100 ml volumes of LB as described above. The cells were harvested by centrifugation ana resuspended in 3 ml. phosphate buffered saline (PBS). After the addition of 80 .mu.l lysozyme (10 mgml.sup.-1 ; the cell suspension was incubated for 10 min at 22.degree. C. Triton X-100 was added to final concentration of 1% and the cells were frozen (-20.degree. C.), thawed and sonicated on ice at 70%, power for 3.times.30 s (model XL2015 sonicator). The lysed cells were centrifuged, and the supernatant was made up to 30 ml with PBS and mixed with 5 ml of Glutathione Sepaharose 4B (Pharmacia Biotech) which had been washed three times with PBS+0.1% Triton X-100. The mixture was stirred for 18 hours at 4.degree. C., centrifuged and washed twice in 100 ml PBS. and then packed into a chromatography column (Poly-Prep: Bio-rad) as a 50% slurry. The GST/V fusion protein was eluted with 10 ml of 50 mM Tris pH 8.0 containing 5 mM reduced glutathione (Pharmacia Biotech). After dialysis against PBS, the fusion protein was cleaved with factor Xa (Boehringer Mannheim UK Ltd) for 18 hours at 22.degree. C., according to the manufacturer's instructions. Cleaved GST and excess uncleaved GSTN were removed from the solution by affinity adsorption, as described above, to leave purified recombinant V (rV). Immunisation with rV. Six week old female Balb/c mice, raised under specific pathogen-free conditions (Charles. River Laboratories, Margate, Kent. UK), were used in this study. A group of 16 mice received a 0.2 ml primary immunising dose intraperitoneally (i.p.) of 10.13 .mu.g of rV antigen, presented in a 1:1 water-in-oil emulsion with Incomplete Freund's Adjuvant (IFA). On days 14 and 34, each animal received booster immunising doses, prepared as above. On day 64, 6 animals were sacrificed and their tissues were removed for immunological analyses. as described below. The remaining animals were challenged with Y. pestis. An untreated control group of 16 age-matched mice were divided similarly into groups for tissue sampling and challenge. In a subsequent experiment to determine the degree of protection against higher challenge doses of Y pestis groups of 5 or 6 rV-immunised and control mice were used. Measurement of serum antibody titre. Blood was sampled by cardiac puncture from mice anaesthetised i.p. with a 0.1 ml cocktail containing 6 mg of Domitor (Norden Laboratories) and 27 .mu.g cf Ketalar (Parke-Davies). The samples were pooled and the serum was separated. The serum antibody titre was measured by a modified ELISA (Willamson and Tiball, (1993) Vaccine 11: 1253-1258). Briefly, rV (5 .mu.gml.sup.-1 in PBS) was coated onto a microtitre plate and the test sera were serially diluted in duplicate on the plate. Bound antibody was detected using peroxidase labelled conjugates of anti-mouse polyvalent 1 g. The titre of specific antibody was estimated as the maximum dilution of serum giving an absorbance reading greater than 0.1 units. after subtraction of the absorbance due to non-specific binding detected in the control sera. Isolation of purified T cells from the spleen. A crude suspension of mixed spleen cells was prepared by gently grinding the spleen on a fine wire mesh. The cells were flushed from the splenic capsule and connective tissue with 2 ml of tissue culture medium (DMEM with 20 mM L-glutamine, 10.sup.5 U1.sup.-1 of penicillin and 100 mgl.sup.-1 of strepomycin). A population of mixed lymphocytes was separated from the spleen cell suspension by density gradient centrifugation of Ficoll-Hypaque (Lymphocyte Separation Medium, ICN Flow). A mixed acridine orange (0.0003% w/v) and ethidium bromide (0.001% w/v) stain was used to determine the percentage of viable cells in the preparation. The mixed lymphocytes were incubated with sheep anti-mouse IgG-coated Dynabeads (M450), Dynal UK) at a ratio of 1:3 for 30 minutes at 4.degree. C. The Dynabead linked B cells were removed by magnetic separation and the remaining T cells were resuspended in DMEM, supplemented with antibiotic and 10% v/v foetal calf serum (FCS) at the desired cell density for seeding to microtitre plates. In vitro proliferation of crude spleen cells and purified T cells against rV. Doubling dilutions of rV or Concanavalin A (positive control) in DMEM (range 0-50 .mu.gml.sup.-1) were made in the wells of a microtitre plate, such that 0.1 ml remained in each well. Negative controls consisted of 0.1 ml of DMEM alone. An equal volume of the crude spleen cell or purified T cell suspension was seeded into each well at a minimum density of 5.times.10.sup.4 cells and incubated for 72 hours at 37.degree. C. (5% CO.sub.2). One .mu.Ci of .sup.3 H thymidine ([methyl[.sup.3 H]thymidine S.A. 74 GBqmmol.sup.-1 ; Amersham) in 30 .mu.l of DMEM supplemented with 10% FCS was aliquoted into each well and incubation was continued for 24 h. The well contents were harvested onto glass fibre filters using a cell harvester (Titertek) and discs representing each well were punched from the filter mats into 1.5 mI of scintillation fluid (Cyoscint. ICN Biomedicals Inc.) so measure the incorporation of .sup.3 H thymidine into cells. The cell stimulation index was calculated from a replicates as mean cpm (stimulated)mean cpm (negative control). Production of recombinant F1 antigen. Cloning of caf1: DNA was isolated from Y. pestis by the method of Marmur et al (1961) J. Mol. Biol. 3: pp 208-218. A DNA fragment encoding the open reading frame of caf1 minus its signal sequence was amplified from this using the polymerase chain reaction (PCR). Oligonucleotides were prepared with a Beckman 200A DNA synthesiser for use in the PCR. pFGAL2a construct. Oligonucleotide GATCGAGCTCGGCAGA7T'AACTGCAAGCACC (SEQ ID No 7) was synthesised corresponding to the first 21 bases of the caf1 gene immediately following the nucleotides encoding the signal sequence with an additional 5'region encoding a SacI site and the complimentary oligonucleotide CAGGTCGAGCTCGTCGACGGTTAGGCTCAAAGTAG (SEQ ID No 8) corresponding to the sequence which encodes a putative `stem loop` structure downstream of the caf1 termination codon with an added 5'region encoding SacI and AccI sites. A DNA fragment was obtained after 35 cycles of amplification (95.degree. C., 15 secs; 50.degree. C., 15 secs; 72.degree. C., 30 secs using a Perkin Elmer 9600 GeneAmp PCR system). The fragment was purified, digested with SacI and AccI, ligated into a similarly digested pUC18 plasmid and transformed into E. coli JM109 by electroporation. Electroporation was carried out using a Biorad Gene Pulser with 0.2 cm cuvettes at 1.25kV. 25pF, 800 Ohms with a time constant of 20. A pFGAL2a colony containing the cloned caf1 gene was identified by PCR using an oligonucleotide TGGTACGCTTACTCTTGGCGGCTAT (SEQ ID No 9) corresponding to an internal region of the gene 128 to 153 nucieotides from the site identified as the signal sequence cleavage site (see Galyov et al (1990)) and the SEQ ID No 2. An F1 expressing E. coli culture containing the pFGAL2a was grown at 37.degree. C. with shaking in Luria Broth with 1 mM isopropyl-.beta.-D-thiogalactopyranoside (IPTG) for 18 hours. Whole cell lysates and periplasmic and cytoplasmic fractions of the bacteria were prepared as described by Sambrook et al (1989). SDS-PAGE and Western blotting: SDS-polyacrylamide gel electrophoresis (PAGE) and Western blotting were performed as described by Hunter et al (1993) Infec. Immun. 61. 3958-3965. Blots were probed with polyclonal antisera raised in sheep (B283) against killed Y pestis (EV76 strain grown at 37.degree. C.) and bound antibody was detected with a horseradish peroxidase-labelled donkey anti-sheep IgG (Sigma). |
| PATENT EXAMPLES | available on request |
| PATENT PHOTOCOPY | available on request |
|
Want more information ? Interested in the hidden information ? Click here and do your request. |