| PATENT NUMBER | This data is not available for free |
| PATENT GRANT DATE | 31.12.02 |
| PATENT TITLE |
Pneumococcal surface proteins and uses thereof |
| PATENT ABSTRACT | The present invention relates to pneumococcal genes, portions thereof, expression products therefrom and uses of such genes, portions and products; especially to genes of Streptococcus pneumoniae, e.g., the gene encoding pneumococcal surface protein A (PspA), i.e., the pspA gene, the gene encoding pneumococcal surface protein A-like proteins, such as pspA-like genes, e.g., the gene encoding pneumococcal surface protein C (PspC), i.e., the pspC gene, portions of such genes, expression products therefrom, and the uses of such genes, portions thereof and expression products therefrom |
| PATENT INVENTORS | This data is not available for free |
| PATENT ASSIGNEE | This data is not available for free |
| PATENT FILE DATE | September 16, 1996 |
| PATENT REFERENCES CITED | McDaniel et al, "Use of insertional inactivaion to facilitate studies of biological properties of pneumococcal surface protein A (PspA)", Journal of Experimental Medicine, vol. 165, No. 2, pp. 381-394, Feb. 1, 1987 |
| PATENT PARENT CASE TEXT | This data is not available for free |
| PATENT CLAIMS |
What is claimed is: 1. An isolated amino acid molecule comprising pneumococcal surface protein C, PspC, of Streptococcus pneumoniae having alpha-helical, proline rich and repeat regions. 2. An immunological composition consisting essentially of the isolated amino acid molecule of claim 1. 3. An isolated amino acid molecule of claim 1 comprising amino acid residue 458 to the C-terminus of PspC as set forth in FIG. 21. 4. An isolated amino acid molecule of claim 1, further comprising a signal sequence consisting essentially of a charged region followed by a hydrophobic core of amino acids. 5. An isolated amino acid molecule of claim 1, wherein the alpha-helical region further comprises a seven residue periodicity and a coiled coil region having three breaks in a heptad repeat. 6. An isolated amino acid molecule comprising pneumococcal surface protein C, PspC, of S. pneumoniae having alpha-helical, proline rich and repeat regions, wherein the alpha-helical region comprises a C-terminus having substantial homology with a protection-eliciting region of PspA. 7. An immunological composition consisting essentially of the isolated amino acid molecule of claim 6. 8. An isolated amino acid molecule of claim 1, further comprising a 17 amino acid, partially hydrophobic tail. 9. An isolated amino acid molecule of claim 6, further comprising a 17 amino acid, partially hydrophobic tail. -------------------------------------------------------------------------------- |
| PATENT DESCRIPTION |
FIELD OF THE INVENTION This invention relates to pneumococcal genes, portions thereof, expression products therefrom and uses of such genes, portions and products; especially to genes of Streptococcus pneumoniae, e.g., the gene encoding pneumococcal surface protein A (PspA) (said gene being "pspA"), pspA-like genes, pneumococcal surface protein C (PspC) (said gene being "pspC"), portions of such genes, expression products therefrom, and the uses of such genes, portions thereof and expression products therefrom. Such uses include uses of the genes and portions thereof for obtaining expression products by recombinant techniques, as well as for detecting the presence of Streptococcus pneumoniae or strains thereof by detecting DNA thereof by hybridization or amplification (e.g., PCR) and hybridization techniques (e.g., obtaining DNA-containing sample, contacting same with genes or fragment under PCR, amplification and/or hybridization conditions, and detecting presence of or isolating hybrid or amplified product). The expression product uses include use in preparing antigenic, immunological or vaccine compositions, for eliciting antibodies, an immunological response (other than or additional to antibodies) or a protective response (including antibody or other immunological response by administering composition to a suitable host); or, the expression product can be for use in detecting the presence of Streptococcus pneumoniae by detecting antibodies to Streptococcus pneumoniae protein(s) or antibodies to a portion thereof in a host, e.g., by obtaining an antibody-containing sample from a relevant host, contacting the sample with expression product and detecting binding (for instance by having the product labeled); and, the antibodies generated by the aforementioned compositions are useful in diagnostic or detection kits or assays. Thus, the invention relates to varied compositions of matter and methods for use thereof. BACKGROUND OF THE INVENTION Streptococcus pneumoniae is an important cause of otitis media, meningitis, bacteremia and pneumonia. Despite the use of antibiotics and vaccines, the prevalence of pneumococcal infections has declined little over the last twenty-five years. It is generally accepted that immunity to Streptococcus pneumoniae can be mediated by specific antibodies against the polysaccharide capsule of the pneumococcus. However, neonates and young children fail to make an immune response against polysaccharide antigens and can have repeated infections involving the same capsular serotype. One approach to immunizing infants against a number of encapsulated bacteria is to conjugate the capsular polysaccharide antigens to protein to make them immunogenic. This approach has been successful, for example, with Haemophilus influenzae b (see U.S. Pat. No. 4,496,538 to Gordon and U.S. Pat. No. 4,673,574 to Anderson). However, there are over eighty known capsular serotypes of S. pneumoniae of which twenty-three account for most of the disease. For a pneumococcal polysaccharide-protein conjugate to be successful, the capsular types responsible for most pneumococcal infections would have to be made adequately immunogenic. This approach may be difficult, because the twenty-three polysaccharides included in the presently-available vaccine are not all adequately immunogenic, even in adults. An alternative approach for protecting children, and also the elderly, from pneumococcal infection would be to identify protein antigens that could elicit protective immune responses. Such proteins may serve as a vaccine by themselves, may be used in conjunction with successful polysaccharide-protein conjugates, or as carriers for polysaccharides. McDaniel et al. (I), J. Exp. Med. 160:386-397, 1984, relates to the production of hybridoma antibodies that recognize cell surface polypeptide(s) on S. pneumoniae and protection of mice from infection with certain strains of encapsulated pneumococci by such antibodies. This surface protein antigen has been termed "pneumococcal surface protein A" or PspA for short. McDaniel et al. (II), Microbial Pathogenesis 1:519-531, 1986, relates to studies on the characterization of the PspA. Considerable diversity in the PspA molecule in different strains was found, as were differences in the epitopes recognized by different antibodies. McDaniel et al. (III), J. Exp. Med. 165:381-394, 1987, relates to immunization of X-linked immunodeficient (XID) mice with non-encapsulated pneumococci expressing PspA, but not isogenic pneumococci lacking PspA, which protects mice from subsequent fatal infection with pneumococci. McDaniel et al. (IV), Infect. Immun., 59:222-228, 1991, relates to immunization of mice with a recombinant full length fragment of PspA. that is able to elicit protection against pneumococcal strains of capsular types 6A and 3. Crain et al, Infect.Immun., 56:3293-3299, 1990, relates to a rabbit antiserum that detects PspA in 100% (n=95) of clinical and laboratory isolates of strains of S. pneumoniae. When reacted with seven monoclonal antibodies to PspA, fifty-seven S. pneumoniae isolates exhibited thirty-one different patterns of reactivity. The PspA protein type is independent of capsular type. it would seem that genetic mutation or exchange in the environment has allowed for the development of a large pool of strains which are highly diverse with respect to capsule, PspA, and possibly other molecules with variable structures. Variability of PspA's from different strains also is evident in their molecular weights, which range from 67 to 99 kD. The observed differences are stably inherited and are not the result of protein degradation. Immunization with a partially purified PspA from a recombinant .lambda. gt11 clone, elicited protection against challenge with several S. pneumoniae strains representing different capsular and PspA types, as described in McDaniel et al. (IV), Infect. Immun. 59:222-228, 1991. Although clones expressing PspA were constructed according to that paper, the product was insoluble and isolation from cell fragments following lysis was not possible. While the protein is variable in structure between different pneumococcal strains, numerous cross-reactions exist between all PspA's, suggesting that sufficient common epitopes may be present to allow a single PspA or at least a small number of PspA's to elicit protection against a large number of S. pneumoniae strains. In addition to the published literature specifically referred to above, the inventors, in conjunction with co-workers, have published further details concerning PspA's, as follows: 1. Abstracts of 89th Annual Meeting of the American Society for Microbiology, p. 125, item D-257, May 1989; 2. Abstracts of 90th Annual Meeting of the American Society for Microbiology, p. 98, item D-106, May 1990; 3. Abstracts of 3rd International ASM Conference on Streptococcal Genetics, p. 11, item 12, June 1990; 4. Talkington et al, Infect. Immun. 59:1285-1289, 1991; 5. Yother et al (I), J. Bacteriol. 174:601-609, 1992; and 6. Yother et al (II), J. Bacteriol. 174:610-618, 1992. 7. McDaniel et al (V), Microbiol. Pathogenesis, 13:261-268. It would be useful to provide PspA or fragments thereof in compositions, including PspA's or fragments from varying strains in such compositions, to provide antigenic, immunological or vaccine compositions; and, it is even further useful to show that the various strains can be grouped or typed, thereby providing a basis for cross-reactivities of PspA's or fragments thereof, and thus providing a means for determining which strains to represent in such compositions (as well as how to test for, detect or diagnose one strain from another). Further, it would be advantageous to provide a pspA-like gene or a pspC gene in certain strains, as well as primers (oligonucleotides) for identification of such a gene, as well as of conserved regions in that gene and in pspA; for instance, for detecting, determining, isolating, or diagnosing strains of S. pneumonia. These uses and advantages, it is believed, have not heretofore been provided in the art. OBJECTS AND SUMMARY OF THE INVENTION The invention provides an isolated amino acid molecule comprising residues 1 to 115, 1 to 260, 192 to 588, 192 to 299, or residues 192 to 260 of pneumococcal surface protein A of Streptococcus pneumoniae. The invention further provides an isolated DNA molecule comprising a fragment of a pneumococcal surface protein A gene of Streptococcus pneumoniae encoding the isolated amino acid molecule. The invention also provides PCR primers or hybridization probes comprising the isolated DNA molecule. The invention additionally provides an antigenic, vaccine or immunological composition comprising the amino acid molecule. The invention includes an isolated DNA molecule comprising nucleotides 1 to 26, 1967 to 1990, 161 to 187, 1093 to 1117, or 1312 to 1331 or 1333 to 1355 of a pneumococcal surface protein A gene of Streptococcus pneumoniae. The DNA molecule can be used as a PCR primer or hybridization probe; and therefore the invention comprehends a PCR primer or hybridization probe comprising the isolated DNA molecule. The invention also includes an isolated DNA molecule comprising a fragment having homology with a portion of a pneumococcal surface protein A gene of Streptococcus pneumoniae. The DNA preferably is the following (which include the portion having homology and restriction sites, and selection of other restriction sites or sequences for such DNA is within the ambit of the skilled artisan from this disclosure): CCGGATCCAGCTCCTGCACCAAAAAC SEQ ID NO:1; GCGCGTCGACGGCTTAAACCCATTCACCATTGG SEQ ID NO:2; CCGGATCCTGAGCCAGAGCAGTTGGCTG SEQ ID NO:3; CCGGATCCGCTCAAAGAGATTGATGAGTCTG SEQ ID NO:4; GCGGATCCCGTAGCCAGTCAGTCTAAAGCTG SEQ ID NO:5; CTGAGTCGACTGGAGTTTCTGGAGCTGGAGC SEQ ID NO:6; CCGGATCCAGCTCCAGCTCCAGAAACTCCAG SEQ ID NO:7; GCGGATCCTTGACCAATATTTACGGAGGAGGC SEQ ID NO:8; GTTTTTGGTGCAGGAGCTGG SEQ ID NO:9; GCTATGGGCTACAGGTTG SEQ ID NO:10; CCACCTGTAGCCATAGC SEQ ID NO:11; CCGCATCCAGCGTGCCTATCTTAGGGGCTGGTT SEQ ID NO:12; and GCAAGCTTATGATATAGAAATTTGTAAC SEQ ID NO:13 (thus, the invention broadly comprehends DNA homologous to portions of pspA; preferably further including restriction sequences) These DNA molecules can be used as PCR primers or probes; and thus, the invention comprehends a primer or probe comprising and of these molecules. The invention further still provides PCR probe(s) which distinguishes between pspA and pspA-like nucleotide sequence, as well as PCR probe(s) which hybridizes to both pspA and pspA-like nucleotide sequences. Additionally, the invention includes a PspA extract prepared by a process comprising: growing pneumococci in a first medium containing choline chloride, eluting live pneumococci with a choline chloride containing salt solution, and growing the pneumococci in a second medium containing an alkanolamine and substantially no choline; as well as a PspA extract prepared by that process and further comprising purifying PspA by isolation on a choline-Sepharose affinity column. These processes are also included in the invention. An immunological composition comprising these extracts is comprehended by the invention, as well as an immunological composition comprising the full length PspA. A method for enhancing the immunogenicity of a PspA-containing immunological composition comprising, in said composition, the C-terminal portion of PspA, is additionally comprehended, as well. An immunological composition comprising at least two PspAs. The latter immunological composition can have the PspAs from different groups or families; the groups or families can be based on RFLP or sequence studies (see, e.g., FIG. 13). Further, the invention provides an isolated amino acid molecule comprising pneumococcal surface protein C, PspC, of Streptococcus pneumoniae having an alpha-helical, proline rich and repeat regions, an isolated DNA molecule comprising a pneumcoccal surface protein C gene encoding the aforementioned PspC, and primers and hybrization probes consisting essentially of the isolated DNA molecule. Still further, an isolated amino acid molecule comprising pneumococcal surface protein C, PspC, of Streptococcus pneumoniae is provided, having an alpha-helical, proline rich and repeat regions, having substantial homology with a protection eliciting region of PspA, and an isolated DNA molecule comprising a pneumoccal surface protein C gene encoding the aforementioned PspC, and primers and hybridization probes consisting essentially of the isolated DNA molecule are provided by the present invention. Additionally, the present invention provides immunological compositions comprising PspC. These and other embodiments are disclosed or are obvious from the following detailed description. |
| PATENT PHOTOCOPY | Available on request |
|
Want more information ? Interested in the hidden information ? Click here and do your request. |