| PATENT ASSIGNEE'S COUNTRY | Austria |
| UPDATE | 04.00 |
| PATENT NUMBER | This data is not available for free |
| PATENT GRANT DATE | 04.04.00 |
| PATENT TITLE |
S)-hydroxynitrilelyase from Hevea brasiliensis |
| PATENT ABSTRACT | A purified (S)-hydroxy-nitrile-lyase is disclosed. Also disclosed is an amino acid sequence for (S)-hydroxy-nitrile-lyase and DNA sequence encoding the same. |
| PATENT INVENTORS | This data is not available for free |
| PATENT ASSIGNEE | This data is not available for free |
| PATENT FILE DATE | 22.12.97 |
| PATENT CT FILE DATE | 10.07.96 |
| PATENT CT NUMBER | This data is not available for free |
| PATENT CT PUB NUMBER | This data is not available for free |
| PATENT CT PUB DATE | 30.01.97 |
| PATENT FOREIGN APPLICATION PRIORITY DATA | This data is not available for free |
| PATENT REFERENCES CITED | Selmar et al. Physiologia Plantarum, 75: 97-101, 1989. |
| PATENT CLAIMS |
We claim: 1. A purified (S)-hydroxy-nitrile-lyase comprising the amino acid sequence as set forth in SEQ ID NO. 12. 2. The purified (S)-hydroxy-nitrile-lyase as claimed in claim 1, encoded by the DNA sequence as set forth in SEQ ID NO. 4. 3. An isolated polypeptide having at least 80% homology with the amino acid sequence set forth in SEQ ID NO. 12 and possessing (S)-hydroxy-nitrile-lyase activity. 4. An isolated DNA having at least 85% identity with the DNA sequence as set forth in SEQ ID NO. 4 and encoding a polypeptide possessing (S)-hydroxy-nitrile-lyase activity. 5. A vector comprising a DNA sequence selected from the group consisting of: (1) a DNA sequence encoding the amino acid sequence as set forth in SEQ ID NO. 12, (2) the DNA sequence as set forth in SEQ ID NO. 4, (3) a DNA sequence having at least 85% identity with the DNA sequence as set forth in SEQ ID NO. 4 and encoding a protein with (S)-hydroxy-nitrile-lyase activity and (4) a DNA sequence encoding a polypeptide having at least 80% homology with the amino acid sequence set forth in SEQ ID NO. 12. 6. A host cell comprising the vector of claim 5. 7. The host cell as claimed in claim 6, wherein the host cell is a microorganism cell. 8. The host cell as claimed in claim 6, wherein the host cell is from Saccharomyces cerevisiae or Pichia pastoris. 9. A recombinant protein comprising the amino acid sequence as set forth in SEQ ID NO. 12. 10. A recombinant protein, which is obtained by heterologous expression of the vector of claim 5 in a host cell. 11. A method of producing a purified (S)-hydroxy-nitrile-lyase or a protein with (S)-hydroxy-nitrile-lyase activity comprising: culturing the host cell of claim 6, isolating the expressed (S)-hydroxy-nitrile-lyase or protein with (S)-hydroxy-nitrile-lyase activity from the cells, and purifying the expressed (S)-hydroxy-nitrile-lyase or protein with (S)-hydroxy-nitrile-lyase activity from the cells. 12. A method of producing (S)-cyanohydrins comprising contacting a purified (S)-hydroxy-nitrile-lyase having the amino acid sequence as set forth in SEQ ID No: 12 with corresponding aldehydes or ketones with HCN or an HCN-donor to form (S)-cyanohydrins. |
| PATENT DESCRIPTION |
BACKGROUND OF THE INVENTION 1. Field of the Invention The carrying out of chemical reactions with the assistance of biological catalysts is becoming increasingly important, especially in those areas of application in which it is possible to exploit the property, which is frequently marked among enzymes, of preferentially converting one of the two enantiomers in reactions with chiral or prochiral components. One of the enzymes used is the (S)-hydroxy-nitrile-lyase (Hnl) from Hevea brasiliensis which catalyzes not only the formation of aromatic but also the formation of aliphatic (S)-cyanohydrins from the corresponding aldehydes or ketones with HCN or HCN donors (EP-A-0 632 130). This is important inasmuch as it is not possible to prepare aliphatic (S)-cyanohydrins with other (S)-hydroxy-nitrile-lyases such as, for example, that from Sorghum bicolor (Tetrahedron Letters, 31: 1249-1252, 1990). 2. Description of the Related Art The previously known Hnl is prepared from the leaves of Hevea brasiliensis by the method of Selmar (Physiologia plantarum 75: 97-101, 1989) and has a molecular weight of 46 kDa (J. E. Poulton in: Cyanide Compounds in Biology [Ciba Foundation Symposium 140], pp 67-91, 1988). However, the enzyme isolated in this way is insufficiently pure for obtaining specific anti-Hnl antibodies or determining amino-acid sequences of the Hnl protein. All attempts to isolate pure HNL [sic] enzyme using other conventional chromatographic purification steps have failed. In all attempts to obtain the enzyme in pure form by ion exchange chromatography with sodium chloride gradient elution, no Hnl activity was detectable in the column eluate. This was successful only after ammonium sulfate was used, in place of the sodium chloride gradient which is otherwise customary, for the elution. The invention accordingly relates to a (S)-hydroxy-nitrile-lyase in purified and isolated form. The Hnl isolated and purified in this way has a molecular weight of 30.+-.1 kDa, a specific activity of 19 IU/mg of protein and comprises the following amino-acid part-sequences: Part-sequence 1: ...-leu-met-glu-val-phe-pro-... (SEQ ID NO:1) Part-sequence 2: ...-gly-ser-leu-phe-gln-asn-... (SEQ ID NO:2) Part-sequence 3: ...-glu-ile-ala-glu-ile-leu-gln-glu-val-ala [sic] (SEQ ID NO:3) This made it possible subsequently, after reverse transcription of mRNA from Hevea brasiliensis, to clone a cDNA copy of the hnl gene, which has the following nucleotide sequence, the amino-acid sequence derived therefrom for the Hnl protein being indicated underneath, and the part-sequences determined from the Hnl protein being indicated by underlining. (-43)G AAG AGC ACA TAT CGA TAG TAA AGA GTA AGA TAT CAT CAG AAA (SEQ ID NO:4) - 1/1 31/11 ATG GCA TTC GCT CAT TTT GTT CTT ATT CAT ACC ATA TGC CAC GGT GCA TGG ATT TGG CAC Met ala phe ala his phe val leu ile his thr ile cys his gly ala trp ile trp his (SEQ ID NO:12) - 61/21 91/31 AAG CTC AAA CCC CTC CTT GAG GCA CTT GGC CAC AAG GTT ACT GCA CTG GAC CTT GCA GCA lys leu lys pro leu leu glu ala leu gly his lys val thr ala leu asp leu ala ala - 121/41 151/51 AGC GGC GTT GAC CCA AGG CAA ATT GAG GAG ATT GGC TCA TTT GAT GAG TAT TCT GAA CCC ser gly val asp pro arg gln ile glu glu ile gly ser phe asp glu tyr ser glu pro - 181/61 211/71 TTG TTG ACG TTC TTG GAG GCA CTC CCT CCA GGG GGA AAG GTG ATT CTG GTT GGC GAG AGC leu leu thr phe leu glu ala leu pro pro gly glu lys val ile leu val gly glu ser - 241/81 271/91 TGT GGA GGA CTC AAT ATA GCA ATT GCT GCT GAT AAA TAC TGT GAA AAG ATT GCA GCT GCT cys gly gly leu asn ile ala ile ala ala asp lys tyr cys glu gly ile ala ala ala - 301/101 331/111 GTT TTC CAC AAT TCA GTA TTG CCA GAC ACC GAG CAC TGC CCA TCT TAC GTC GTG GAT AAG val phe his asn ser val leu pro asp thr glu his cys pro ser tyr val val asp lys - 361/121 391/131 CTC ATG GAG GTG TTT CCC GAC TGG AAA GAC ACC ACG TAT TTT ACG TAC ACT AAA GAT GGC leu met glu val phe pro asp trp lys asp thr thr tyr phe thr tyr thr lys asp gly - 421/141 451/151 AAG GAG ATA ACT GGA TTG AAA CTG GGC TTC ACG CTT CTG AGG GAA AAT TTA TAT ACC CTT lys glu ile thr gly leu lys leu gly phe thr leu leu arg glu asn leu tyr thr leu - 481/161 511/171 TGC GGT CCT GAG GAA TAT GAA CTG GCG AAG ATG TTG ACA AGG AAG GGA TCA TTA TTT CAA cys gly pro glu glu tyr glu leu ala lys met leu thr arg lys glu ser leu phe gln - 541/181 571/191 AAT ATT TTA GCT AAG CGA CCA TTC TTC ACT AAG GAA GGT TAC GGA TCG ATT AAG AAA ATT asn ile leu ala lys arg pro phe phe thr lys glu gly tyr gly ser ile lys lys ile - 601/201 631/211 TAT GTG TGG ACC GAC CAA GAC GAA ATA TTT TTA CCT GAA TTT CAA CTC TGG CAA ATA GAA tyr val trp thr asp gln asp glu ile phe leu pro glu phe gln leu trp gln ile glu - 661/221 691/231 AAC TAT AAA CCA GAC AAG GTT TAT AAG GTC GAA GGT GGA GAT CAT AAA TTG CAG CTT ACA asn tyr lys pro asp lys val tyr lys val glu gly gly asp his lys leu gln leu thr - 721/241 751/251 AAG ACT AAG GAG ATC GCT GAA ATT CTC CAA GAG GTG GCT GAT ACC TAT AAT TGA CTT CTT lys thr lys glu ile ala glu ile leu gln glu val ala asp thr tyr asn OPA - TGAGGCTTTTTGTTACTATTAAGTATGGGAGCAACTATGAGTTAATAATCTCACATTTTCAAGTGGGAA TTAAGTTGTG - CTAAAATAAAGTTG TTTATTGTGTTGTAATTT TTTTTTCATTTGAAGTGG GACAGTCTCGCACGCTTT CGAGACTCTTT - ATTTATATATATAA TGTAAGTGTGTATTTAAG GGAAAGCTACCCCTATTG TGTAGCTTATCATGCTTT TCTTTGAATCA - AATAAATAAAACTT ATTT The cDNA comprises the complete coding region of the hnl gene with an open reading frame for a polypeptide of 257 amino acids. The molecular weight was calculated to be 29,227 Da from the amino-acid sequence of the coding [sic] protein which was deduced from the DNA sequence determined. The invention accordingly also relates to a DNA sequence which codes for (S)-hydroxy-nitrile-lyase or is more than 85% identical to this sequence in the region coding for hydroxy-nitrile-lyase. It was obtained by reverse transcription from mRNA. The cDNA is the basis for obtaining enzyme preparations by heterologous expression in various host organisms. The present invention accordingly also relates to recombinant proteins which can be prepared by heterologous expression of the hnl gene (cDNA) from Hevea brasiliensis in suitable microorganisms, preferably in eukaryotic microorganisms. It has emerged in particular that recombinant Hnl protein which has been prepared by heterologous expression of the Hevea brasiliensis hnl gene (cDNA) in eukaryotic microorganisms, such as, for example, in Saccharomyces cerevisiae or Pichia pastoris, differs distinctly from the natural Hnl protein isolated from the plant Hevea brasiliensis. The essential characteristic is that the specific activity of such a recombinant Hnl protein is distinctly higher than the specific activity of the purified natural protein from Hevea brasiliensis. The differences are also manifested in the electrophoretic behavior of the proteins. Both on isoelectric focusing and on separation in native polyacrylamide gels, the protein bands of the purified recombinant and natural Hnl proteins are found at different positions. It is assumed that this different behavior is attributable to post-translational modification processes which do not take place identically in the plant and in the microorganisms, and that the higher specific activity of the recombinant Hnl protein is attributable to protein molecules which are modified differently in eukaryotic microorganisms. |
| PATENT EXAMPLES | This data is not available for free |
| PATENT PHOTOCOPY | Available on request |
|
Want more information ? Interested in the hidden information ? Click here and do your request. |